Pcmv3-sp-n-his

Author: enny

August undefined, 2024

SpletA Myc tag is a polypeptide protein tag derived from the c-Myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. SpletpCMV3–untagged: Vector Size: 6166bp: Vector Type: Mammalian Expression Vector: Expression Method: Constitutive, Stable / Transient: Promoter: CMV: Antibiotic …

Human BOLA1 Expression-Ready ORF Clone (pCMV3-SP-N-His)

SpletSchematic of pCMV3-SP-N-His Multiple Cloning Sites Vector Name pCMV3-SP-N-His Vector Size 6149bp Vector Type Mammalian Expression Vector Expression Method … SpletpCMV3-C-His: Vector Size: 6104bp: Vector Type: Mammalian Expression Vector: Expression Method: Constitutive, Stable / Transient: Promoter: CMV: Antibiotic … servicenow public ips

Mouse BAFF / TNFSF13B ORF mammalian expression plasmid, N-His …

SpletMERS-CoV was first discovered in Saudi Arabia in September 2012. It is similar to the SARS virus in its clinical symptoms. It was also named SARS-like virus in the early days. It is the sixth known human coronavirus. MERS-CoV is often confused with SARS, but in fact both viruses belong to the coronavirus, but they are genetically distinct and ... Splet• pCMV3-SP-N-His More Reagents and Services • cDNA / Clones • qPCR Primer • Transfection Reagent Sino Biological, Inc. (China) Building 9, Jing Dongbei Technology Park, No.18 Kechuang 10th St, BDA, Beijing, 100176, P.R.China Sino Biological US Inc. (U.S.A.) Pennsylvania Office: 1400 Liberty Ridge Drive, Suite 101, Wayne, PA 19087 SpletpCMV3-N-HA: Vector Size: 6041bp: Vector Type: Mammalian Expression Vector: Expression Method: Constitutive, Stable / Transient: Promoter: CMV: Antibiotic Resistance : … the terminal list reviews rotten tomatoes

Standard Motor Products V303 PCV Valve - amazon.com

pCMV3-C-Flag Vector Sino Biological

SpletSino Biological은 재조합 Recominant protein, Antibody, ELISA kit 등과 같은... Splet11. nov. 2005 · Brand: Standard Motor Products. 14 ratings. $949. Get Fast, Free Shipping with Amazon Prime. FREE Returns. Available at a lower price from other sellers that may … the terminal list part 2Splet(A) pCMV3-SP-N-His-Gal-1 mediated overexpression and shRNA mediated knockdown of galectin-1 were confirmed by real-time PCR (A, B, D, E) and western blotting (C, F), … servicenow pro vs standard

"SpletA Myc tag is a polypeptide protein tag derived from the c-Myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein ... " - Pcmv3-sp-n-his

Pcmv3-sp-n-his

Human CD274 / B7-H1 / PD-L1 ORF mammalian expression plasmid, N-His …

SpletSchematic of pCMV3-SP-N-His Multiple Cloning Sites Vector Name pCMV3-SP-N-His Vector Size 6149bp Vector Type Mammalian Expression Vector Expression Method … SpletpCMV3-SP-N-HA is recommended for constructing the N-HA tag secretary and membrane proteins expression vector which containing a naïve signal peptide. An universal signal peptide is used to instead the naïve signal peptide. HA Tag Information

Did you know?

SpletpCMV3-N-His vector backbone. + Sequence information. + Datasheet. + Compare & Order pCMV3-N-His vector backbone products + TOP customer support. English +1 877 302 … SpletExpression Vector pCMV3-SP-N-HA Information Description. pCMV3-SP-N-HA is recommended for constructing the N-HA tag secretary and membrane proteins …

SpletExpression-ready Mouse CXCR3 cDNA ORF clone (MG50842-NF) with enhanced promotor in expression vector (pCMV3-SP-N-FLAG) is confirmed by full-length sequence and validated in expression capability for gene expression studies or other applications. Quote for bulk production. SpletpCMV3-SP-N-HA is recommended for constructing the N-HA tag secretary and membrane proteins expression vector which containing a naïve signal peptide. An universal signal peptide is used to instead the naïve signal peptide. HA Tag Information

SpletFLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild … SpletVector : pCMV3-SP-N-His Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. Storage : The lyophilized plasmid can be stored at ambient temperature for three months. Quality control : The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. Sequencing primer list :

Splet21. jan. 2024 · Following cell attachment overnight, cells were transfected with 1 μg/mL His tagged (pCMV3-SP-N-His-NCV) and His-GHRH (pCMV3-SP-His-ORF) plasmids and 6 μL ScreenFect A (ScreenFect, Eggenstein-Leopoldshafen) for 48 h. After incubation, cells were selected by hygromycin (Neofroxx, Einhausen, Germany) with increasing concentration …

SpletEnhanced CMV promoter Vector pCMV3-SP-N-His Restriction Sites KpnI + XbaI (6kb + 0.39kb) Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC Sequencing Primers T7 ( 5' TAATACGACTCACTATAGGG 3' ) BGH ( 5' TAGAAGGCACAGTCGAGG 3' ) Quality Control The plasmid is confirmed by full-length … the terminal list repartoSplet31. maj 2024 · fection. Cells were then transfected with pCMV3-SP-N-His (pCMV3, control group) (Sino Biological, Beijing, China) or pCMV3-MMP9 (MMP9 overexpres-sion group) (Sino Biological, Beijing, China) at a ﬁnal concentration of 0.8lg/ml by Lipofectamine 2000 (Thermo, USA). After 48 h, cells were stimulated with different concentrations of P ... the terminal list saison 1 vostfrSpletExpression-ready Human FPR3 cDNA ORF clone (HG11645-NH) with enhanced promotor in expression vector (pCMV3-SP-N-His) is confirmed by full-length sequence and validated in expression capability for gene expression studies or … servicenow quick message templateSpletpCMV3-SP-N-HA is recommended for constructing the N-HA tag secretary and membrane proteins expression vector which containing a naïve signal peptide. An universal signal peptide is used to instead the naïve signal peptide. HA Tag Information the terminal list primeSpletExpression Vector pCMV3-N-His Information Description His Tag Information A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine … the terminal list saison 1SpletMicroseminoprotein-beta (MSMB) is a major secretory product from prostate epithelial cells. MSMB synthesis is decreased in prostate tumors concerning tumor grade. MSMB levels are also reduced in the circulation and MSMB is therefore used as a serum biomarker for prostate cancer. servicenow public knowledge articleSpletpCMV3-SP-N-His: Vector Size: 6089bp: Vector Type: Mammalian Expression Vector: Expression Method: Constitutive, Stable / Transient: Promoter: CMV: Antibiotic … servicenow read only admin